1. M Cell Peyer`s Patch Download Free Windows 7

Background & AimsIntestinal microfold (M) cells are specialized epithelial cells that act as gatekeepers of luminal antigens in the intestinal tract. They play a critical role in the intestinal mucosal immune response through transport of viruses, bacteria and other particles and antigens across the epithelium to immune cells within Peyer’s patch regions and other mucosal sites. Recent studies in mice have demonstrated that M cells are generated from Lgr5+ intestinal stem cells (ISCs), and that infection with Salmonella enterica serovar Typhimurium increases M cell formation. However, it is not known whether and how these findings apply to primary human small intestinal epithelium propagated in an in vitro setting.

M Cell Peyer`s Patch Download Free Windows 7

ResultsFunctional M cells were generated by short-term culture of freshly isolated human intestinal crypts in a dose- and time-dependent fashion. RANKL stimulation of the monolayer cultures caused dramatic induction of the M cell-specific markers, SPIB, and Glycoprotein-2 ( GP2) in a process primed by canonical WNT signaling. Confocal microscopy demonstrated a pseudopod phenotype of GP2-positive M cells that preferentially take up microparticles. Furthermore, infection of the M cell-enriched cultures with the M cell-tropic enteric pathogen, S.

Typhimurium, led to preferential association of the bacteria with M cells, particularly at lower inoculum sizes. Larger inocula caused rapid induction of M cells. ConclusionsHuman intestinal crypts containing ISCs can be cultured and differentiate into an epithelial layer with functional M cells with characteristic morphological and functional properties. This study is the first to demonstrate that M cells can be induced to form from primary human intestinal epithelium, and that S. Typhimurium preferentially infect these cells in an in vitro setting. We anticipate that this model can be used to generate large numbers of M cells for further functional studies of these key cells of intestinal immune induction and their impact on controlling enteric pathogens and the intestinal microbiome. Citation: Rouch JD, Scott A, Lei NY, Solorzano-Vargas RS, Wang J, Hanson EM, et al.

(2016) Development of Functional Microfold (M) Cells from Intestinal Stem Cells in Primary Human Enteroids. PLoS ONE 11(1):e0148216.Chunming Liu, University of Kentucky, UNITED STATESReceived: November 4, 2015; Accepted: January 14, 2016; Published: January 28, 2016This is an open access article, free of all copyright, and may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for any lawful purpose. IntroductionThe single layer of epithelial cells that lines the entire intestinal tract is the primary physical barrier separating the intestinal lumen and its content from the intestinal lamina propria and the body’s interior. Various mechanisms have been proposed to explain enteral uptake of viruses and microbes, including disruptions of the epithelial barrier, transcytosis across enterocytes, infection of juxtaposed dendritic cells and/or lymphocytes, and through microfold (M) cells located within the follicle-associated epithelium (FAE) that overlies Peyer’s patches , or are scattered along the villus-independent of Peyer’s patches. These cells represent a major site for the sampling of gut luminal antigens, and are important for enteral uptake of various commensal microorganisms, and viral and bacterial pathogens including Salmonella enterica serovar Typhimurium, Vibrio cholerae, HIV, Reovirus, Poliovirus and others –.M cells lack the typical tightly packed long microvilli characteristic of enterocytes, and instead have disorganized stubby microvilli along their apical border.

In addition, M cells have deep basolateral invaginations that are often found to harbor immune cells. This morphology allows for efficient antigen and microbial sampling along with rapid transcytosis. Thus far, the assessment of how various pathogens are transmitted across the human intestinal epithelial layer has been limited to immortalized colon cancer cell lines –.All epithelial cells of the gut are derived from dividing crypt-based intestinal stem cells (ISCs) that undergo long-term self-renewal to maintain the stem cell population and are uniquely identified by expression of Lgr5. The differentiated epithelial lineages of the small intestine include Paneth cells, goblet cells, tuft cells, enterocytes, enteroendocrine cells, and M cells, all of which have specialized roles required for proper alimentation within the context of a complex symbiotic luminal microbiota. By nature, the ISCs are particularly sensitive to injury under stressful conditions including infection; however, a quiescent cell population of secretory progenitor cells (+4 cells) can de-differentiate into bona fide LGR5+ rapidly dividing ISCs.

Under both homeostatic and stressed conditions, the function of ISCs and the quiescent +4 cell are believed to be influenced by various cells within the niche–including subepithelial myofibroblasts, lymphocytes, macrophages, and dendritic cells.Epithelial lineage differentiation in the small intestine is controlled a complex cascade of lineage-specific transcription factors that are activated by the Notch signaling pathway in ISCs and early progenitor cells which dictates differentiation into absorptive or secretory cell lineages –. Furthermore, lineage differentiation is influenced by the cellular microenvironment. For example, development of M cells located within the FAE is controlled in mice by a subepithelial network of reticular cells and B cells that secrete the cytokine, receptor activator of NF-κB ligand (RANKL)—a type II member of the tumor necrosis factor superfamily.

The binding of RANKL to its receptor, RANK (TNFRSF11a), activates the non-canonical (RelB) NF-κB signaling pathway, and induces the expression of SpiB, an ETS-transcription factor that drives M cell fate determination and maturation –.Recent studies have demonstrated that M cells can be generated using a murine in vitro enteroid model in a RANKL-dependent manner. Lineage-tracing studies demonstrated that M cells are derived from LGR5+ ISCs through RANKL induction of SpiB. RANKL stimulation of LGR5+ crypts from SpiB null mice failed to generate M cells, confirming that SpiB expression is required for M cell development. In addition, acute S. Typhimurium infection in mice has been shown to induce rapid transdifferentiation of enterocytes into functional M cells through WNT/ β-catenin and NF-κB dependent epithelial mesenchymal transition (EMT). This follows similar patterns of EMT observed in other cell types through the same WNT/ β-catenin and NF-κB signaling pathways –.Intestinal enteroids are an in vitro model that supports the proliferation and differentiation of ISCs into the full array of epithelial lineages that comprise the lining of the gut.

Several groups, including our own, have developed methods to grow human enteroids including in a 2D modular configuration using Transwells that separates luminal and subepithelial compartments ,. Here we set out to adapt the enteroid model for the formation of M cells from proximal human small intestinal crypts, and characterize the cells in regard to their ability to endocytose microparticles and permit uptake of S.

Typhimurium, both of which are characteristics of M cells in vivo. RANKL-Induces M Cell Differentiation in a Dose- and Time-Dependent FashionPrimary human intestinal crypts isolated from discarded surgical samples of the proximal small intestine were grown on both 2D collagen-coated plates, and as 3D Matrigel plugs in ENRY medium that promotes their growth , with and without addition of recombinant RANKL every other day.

RANKL stimulated a marked increase in SPIB expression at each concentration tested in 2D-grown monolayers when compared to proximal whole small bowel controls. Similarly, RANKL promoted expression of GP2, a cell surface marker specifically expressed on M cells and absent on other ISC-derived cells in a concentration- and time-dependent manner. Increased expressed of SPIB and GP2 were first evident at day 4 and peaked at day 7 following RANKL exposure , data not shown.

Similar results were obtained when enteroids were grown in 3D configuration (data not shown). RANKL induces M cell differentiation in a dose and time dependent manner.(A) Dose-dependent increases of SPIB and GP2 mRNA expression in 50, 100 and 200 ng/mL RANKL and ENRY treated monolayers assessed at day 5.

(B) Time course of SPIB and GP2 peaked expression levels in monolayers treated with and without 200ng/mL RANKL. (C) Time decay of SPIB and GP2 expression among monolayers receiving 0, 1, 2, or 3 doses of RANKL every other day from day 0, and assessed on days 7, 9, 11 and 13. All results normalized to GAPDH expression in human whole proximal small bowel or crypts, as indicated. RANKL induces M cell surface marker presence and typical morphology.(A) Epifluorescense imaging (100X magnification) of human intestinal monolayers showing uniform expression of epithelial cell surface marker EPCAM in no RANKL and RANKL-treated monolayers, confirming epithelial origin. This is in comparison to M cell surface marker GP2 absence in no RANKL group versus positive GP2 staining in RANKL monolayer groups.

(B) Confocal microscopy assessment (400X magnification) of immunostained RANKL treated monolayers showing membrane surface and cytoplasmic GP2 staining, demonstrating the characteristic M cell morphology of pseudopod-like projections (white arrows). Scale bar 100 μm. Canonical WNT Primes Stem Cells for RANKL-Induced M Cell FormationIn vitro expansion of human enteroids is known to require canonical-WNT stimulation where R-spondin (RSPO) is indispensable, while WNT3a, and/or the GSK-3β inhibitor, CHIR99021 (GSKi) enhance robust growth ,. RSPO, a potent inducer of the canonical-WNT pathway, significantly potentiated the time-dependent increase in SPIB and GP2 expression when used alone even in the absence of RANKL. To further assess the consequences of canonical-WNT on M cell differentiation, two experiments were performed. The first examined the effect of GSKi with and without RANKL, while the second determined the effect of various doses of WNT3a prior to passaging the cells in the presence or absence of RANKL.GSKi that was added on day 0 in the absence of RANKL increased GP2 and SPIB transcripts by six-fold at an early time point (day 4). By day 7, however, the ENRY only group (without GSKi) reached the same levels of GP2 and SPIB expression, which suggests the possible role of RSPO synergism at later time points.

As shown above, however, RANKL administration was required to achieve 100-fold enhanced ability for monolayers to form M cells. Canonical-WNT signal primes ISCs for RANKL induced M cell differentiation(A) Time course of SPIB and GP2 peaked expression levels in monolayers treated with and without 200ng/mL RANKL. (B) Cells were treated with 0%, 5%, and 50% WNT3a-CM for 7 days, and on day 0 and 2 of the subsequent passage, cells were treated with ±200ng/mL RANKL and assessed 5 days later. All samples received ENRY complete medium and were assessed by quantitative PCR; all results normalized to GAPDH expression in human whole small bowel or crypts, as indicated. Cultured M Cells Demonstrate Functionality with Increased Microparticle UptakeM cells have a high capacity to endocytose and transcytose particulates. Utilizing the same mechanisms that facilitate viral and bacterial transcytosis, M cells take up nanospheres as small as 20 nm, and microparticles as large as 10 μm. The highest uptake rates are observed with particles of 1 μm diameter ,.

To explore the endocytic properties of in vitro derived human M cells, we incubated RANKL-treated monolayer cultures with fluorescent latex microparticles (1 μm) and performed confocal microscopy after 60–120 minutes. Microparticles were observed within GP2-positive cells using a Z-stack projection. By comparison, non-RANKL treated monolayers stained with the ubiquitous epithelial marker, E-cadherin, showed a lack of any microparticle uptake. Quantification by epifluorescence microscopy confirmed significantly greater (18-fold) microparticle uptake in RANKL-treated monolayer cultures compared to the non-RANKL treated group. RANKL treated monolayers demonstrate functional M cells through uptake of fluorescent 1μm Texas Red latex microparticles.(A) Confocal microscopy z-stack assessment (400X magnification) showing colocalization of fluorescent 1μm Texas Red latex microparticles and GP2 positive stained M cells with enlarged sections x,y showing clumping of microparticles. (B) Confocal microscopy section (400X magnification) of non-RANKL monolayer stained for E-cadherin (CDH1), a cell surface marker that M cells lack, demonstrating uniform and ubiquitous staining, as well as lack of any Texas Red microparticle internalization.

(C) RANKL treated monolayers show significantly increased numbers of retained fluorescent microparticles after washing, as assessed by three random high power field areas under confocal microscopy z-stack projections (400x). Scale bar 50 μm. Preferential Uptake of S. Typhimurium into Cultured M CellsM cells function as a gateway for many bacterial and viral pathogens to initiate host infection.

For example, S. Typhimurium exploits the phagocytic properties of M cells by preferentially adhering to and entering M cells in the intestinal mucosa ,; however, this has never been shown with primary human cells To further explore the utility of our M cell model, we infected RANKL-treated and untreated monolayers with GFP-labeled S. Typhimurium for 1 h, washed the cultures, and incubated them for an additional hour with gentamicin to kill the remaining extracellular bacteria.

Among RANKL untreated monolayers, there was very limited bacterial uptake in the 10^5 and 10^6 inocula, but a more generalized cellular uptake in the 10^7 inoculum. When compared to RANKL treated groups, bacteria were preferentially associated with GP2-positive M cells over a range of inocula.

Specifically, low (10^5 and 10^6) inocula non-M cells show a very low predilection for bacterial uptake, whereas, normalized to cell density, M cells were 50 and 65-fold more likely to contain S. Typhimurium. In other words, virtually all S. Typhimurium bacteria were localized within M cells in these lower inocula. However, high inoculum (10^7) cultures show some bacterial co-localization both non-M cells and M cells.

The key difference is that M cells in the high inoculum culture demonstrate a significantly higher density of bacterial sampling, containing many bacteria in each cell. Taken together, this data suggest that M cells preferentially endocystose S. Typhimurium bacteria, but at a critical concentration, invasion of non-M cells becomes possible. Cultured M cells preferentially uptake S.

Typhimurium.(A) Epifluorescense imaging (100X) of monolayers without RANKL inoculated with 10^5, 10^6 and 10^7 CFUs of wild type GFP- S. (B) Epifluorescense imaging (100X) of a RANKL treated monolayer inoculated with 10^6 CFUs of wild type GFP- S. Typhimurium showing uptake within GP2 stained cells, and respective magnification x,y showing clumping of many GFP-bacteria within the cell border. (C) Epifluorescense imaging (100X) of a RANKL treated monolayer inoculated with 10^7 CFUs of wild type GFP- S.

Typhimurium showing increased overall GFP- S. Typhimurium uptake in clusters containing M cells x,z compared to non-M cell cluster y. (D) Normalized to cell density per high power field, S. Typhimurium bacteria were specifically associated with GP2-positive M cells in all inocula (log10 scale). (E) High inoculum S. Typhimurium associated with an increased number of M cells after only 60 minutes of bacterial presence; Scale bar 100μm;.

p. Typhimurium Induces M Cell DifferentiationBacterial challenge, specifically with S. Typhimurium, in bovines was shown to induce rapid (. DiscussionWe have developed a robust human in vitro model that is enriched for M cells grown from crypts of the proximal small intestine. The cultured M cells demonstrate several of the characteristic mRNA transcripts and cell surface markers of M cells in vivo, as well as the capability to internalize microparticles and bacteria such as S. To the best of our knowledge, this is the first report of a tractable human M cell model system.We have previously shown that human intestinal enteroids can be grown from discarded surgical samples and propagated indefinitely by weekly passage ,.

Cells in this system retained the ability to differentiate into different epithelial lineages representative of crypt and villi, but they lacked M cell markers under typical culture conditions. This current study expands upon our previous work by demonstrating that functional M cells can be generated in culture in a robust manner that recapitulates human M cells formation and function in vivo.Most M cell studies have focused on FAE, which overlies Peyer’s patches and is part of a continuous epithelial layer of the small intestine. In murine studies, M cell fate is dependent on RANKL stimulation, which induces the expression of SpiB through the WNT/ β-catenin pathway ,. Bacterial mediated mechanisms have also been shown to exploit the WNT/ β-catenin pathway to induce rapid de novo M cell formation through a process of epithelial mesenchymal transition. This study confirms prior knowledge that activation of the canonical-WNT pathway primes M cell differentiation; however, ultimate M cell differentiation is entirely dependent on RANKL through the NF-κB pathway. Specifically, our data suggest significant induction of SPIB transcription activity even without RANKL stimulation in control groups receiving either RSPO alone or in combination with GSKi Figs and.

However, exogenous RANKL is required to achieve optimal levels of SPIB activity to drive M cell generation. As expected, low dose WNT3a showed higher M cell marker expression compared to higher doses, likely because overstimulation with canonical WNT attenuates the more fully differentiated state.Consistent with work done in mice, our data shows that the SPIB expression peaks after 2 days of RANKL administration, with GP2 levels peaking at day 4, and persisting through day 7 , data not shown.

We show that optimal RANKL delivery was at a concentration of 200 ng/mL administered at day 0 and day 2 only, while repeat dosing failed to further enhance M cell generation.In our monolayer cultures, we found evidence of deep pockets within M cells combined with pseudopod extensions. Additionally, we noticed a trail of GP2 staining adjacent to many of the M cells, and since GP2 selectively binds to the FimH component of the type I pili of S.

Typhimurium and other pathogens, we expected to find bacteria adjacent to and within M cells. This could possibly suggest GP2 shedding during the course of M cell movement toward the periphery, which may be related to typical movement along the FAE.A crucial feature of M cells is their role as antigen sampling and transcytotic sites. Microparticles have been targeted to M cells in in vivo animal studies for vaccine, adjuvant therapy and drug delivery. Multiple reports have characterized size parameters for uptake into M cells, showing they are capable of taking up particles from 50 nm to 10 μm, although particles in the 0.5–2 μm range are transcytosed most effectively ,. We observed clumping of microparticles within M cells—suggesting that multiple particles may reside in the same phagosome. The ability to create M cells from human intestinal crypts that have functional uptake of microparticles may improve high-throughput methods for optimization of vaccine and drug delivery ,.Many invasive bacteria cross the mucosal barrier often by exploiting the transcytotic ability of M cells and occasionally can be spread hematogenously –.

Typhimurium not only invades M cells, but also through secretion of a type III effector protein named SopB, induces rapid differentiation of FAE enterocytes into M cells. Interestingly, this occurs through inhibition of GSK3 β, or the same β-catenin mediated mechanism as described above that we utilized to prime ISCs for M cell development. SopB was found to induce both the RANKL and the receptor RANK via WNT signaling, and was able to cause enterocyte transition within 60–180 minutes. Specifically, SopB secreted by S. Typhimurium and other pathogens induce rapid transdifferentiation of enterocytes into M cells via EMT. However, in the bovine model, SopB-induced transition to M cells was limited to FAE crypts and was not observed in ordinary crypts.

In contrast, we found that increases in the density of S. Typhimurium delivery was associated with an increases in M cell number in non-FAE crypts isolated from the proximal bowel. The ability of proximal bowel crypts to be responsive to RANKL would suggest the presence of its receptor, RANK, or other important components of the signaling pathway in epithelium that might be capable of differentiating to M cells.

Further experiments with increasing time of Salmonella presence would further characterize the time course of M cell transition that occurs with SopB presence.The putative WNT source within the gut is more prominent within the niche located in the crypt base, and one might anticipate that since FAE are flat dome-like structures without the typical villus structure, that WNT signaling may be potent throughout. However, the requirement of WNT/RANKL signaling to generate M cells would suggest that along the villus length in non-dome structures, M cells may differentiate at the crypt base and whether it retains M cell feature once these signals diminish would need to be addressed.

Nevertheless, the lymphoid follicles in the gut are enriched with B cell expressing RANKL and their abundance and proximity likely accounts for the enrichment of M cell within the FAE. Additional assessments should include whether M cells generated from non-FAE crypts have a mesenchymal phenotype, and whether EMT or MET are common fates outside of the FAE during homeostatic and disease states such as during chronic inflammation or infection such as in environmental enteropathy will require further assessments using similar in vitro model systems.

Cell CultureA thin film of liquid type I collagen (Advanced BioMatrix, San Diego, CA) was plated onto the bottom surface of 48-well Nucleon Delta-treated cell culture plate (Thermo Scientific, Waltham, MA) at a concentration of 100 ng/mL, incubated for 30 minutes, and then removed by aspiration. Human crypts were plated at a density of 500 crypts per well. These were grown as monolayers in Basic Medium with antibiotic-antimycotic (Invitrogen), 1 mM N-Acetylcysteine (Sigma), 100 ng/ml recombinant murine Noggin (PeproTech), 50 ng/ml recombinant murine EGF (PeproTech), 1xN2 supplement (Invitrogen), 1xB27 supplement (Invitrogen), 1 μg/ml recombinant human R-spondin 1 (R&D Systems, Minneapolis, MN), 10 μM Y-27632 inhibitor (Stemgent), 1 mM recombinant human Jagged-1 (R&D Systems), 5 μM CHIR99021 (GSK-3β inhibitor) (Stemolecule). Alternatively, crypts were suspended within Matrigel at a concentration of 100 crypts per 25 μl of Matrigel and plated in 3D on the 48-well Nucleon Delta-treated cell culture plate. Subculturing of Human MonolayersTo examine the effect of WNT3a priming, a subset of monolayer cultures were treated with 0%, 5%, and 50% L-WNT3a conditioned medium (WNT3a CM), which was prepared as previously described, for 7 days. After seven days of WNT3a-CM treatment, monolayers were digested using TrypLE (Life Technologies) at 37°C for three minutes. TrypLE was then quenched using 10% FBS in ADMEM/F12 and structures were mechanical split into small clusters of cells.

In a 1:2 or 1:3 split, cell cluster were re-plated onto collagen-coated plates and split into 0%, 5% and 50% WNT3a-CM groups with and without 200 ng/mL RANKL. Immunofluorescence and Confocal MicroscopyMonolayers cultured with and without latex microparticles were stained for Glycoprotein-2 (GP2) (MBL), E-cadherin (CDH1) (Dako), and Epithelial cell adhesion molecule (EPCAM) (Abcam). Epifluorescence microscopy was used to characterize differences between RANKL treated and non-treated groups. Confocal microscopy was used to characterize morphologic characteristics, as well as confirm z-stack co-localization of Texas Red latex microparticles within cells. Typhimurium InoculationAfter 4–9 days of culture, RANKL treated and untreated monolayers were inoculated with different inocula of GFP-labelled S. Typhimurium. Antibiotics were removed by repeated washing before infections.

Monolayers were then inoculated with 10^5, 10^6 and 10^7 CFU of GFP-labeled bacteria. After 1 h, plates were incubated with gentamicin for 15–60 mins, and washed three times with PBS. Monolayers were then fixed with 3.4% formalin for 5 mins.Monolayers were stained for GP2 and DAPI, and epifluorescence imaging was used to quantify GFP-labeled Salmonella inside GP2-positive cells as well as in non-GP2 stained cells in three randomly chosen high power fields. RNA AnalysisAt various time points, monolayer and three-dimensional cultures were harvested, and messenger RNA (mRNA) was isolated using Trizol Reagent (Life Technologies) method. Reverse transcriptase polymerase chain reaction (RT-PCR) was performed to characterize expression of GP2, SPIB, Chromogranin A ( CHGA), and Glyceraldehyde-3-phosphate dehydrogenase ( GADPH).

RT-PCR reactions were performed on a Prism 7900 HT Sequence Detection System (Applied Biosystems). Cycle numbers were analyzed according to the comparative CT method using GAPDH as the internal calibrator and human intestinal crypts as the reference tissue. Texas red microparticles and Human ISC monolayers.(Fig A) Epifluorescense + light microscopy (25X) of a 2μL droplet of 1μm Texas red microparticles, and epifluorescense imaging (100X) of microparticles only pre- and post-washing demonstrating that microparticles can be washed away. (Fig B) Light microscopy (25X) of confluent monolayer of RANKL untreated and treated cells. (Fig C) Epifluorescense and light microscopy (100X) of RANKL-untreated and -treated monolayers incubated with Texas red microparticles and washed thrice showing greater microparticle presence in RANKL-treated group.(TIF).

Mucosal epithelium M cells are dispersed across Peyer’s patch follicle associated epithelium (PPFAE) with minimal clustering. Since Notch signaling can influence patterning in epithelia, we examined its influence on PPFAE M cell distribution. Conditional deletion of Notch1 in intestinal epithelium increased PPFAE M cells and also increased M cell clustering, implying a role for Notch in both M cell numbers and lateral inhibition. By contrast, conditional deletion of the ligand Jagged1 also increased M cell clustering, but with a paradoxical decrease in M cell density. In vitro, inhibition of Notch signaling reduced expression of an M cell associated gene CD137, consistent with cis-promoting effects on M cell development.

Thus, Jagged1 may have a cis-promoting role in committed M cells, but a trans- inhibitory effect on neighboring cells. In sum, Jagged1-Notch signaling may edit the pattern of M cells across the PPFAE, which may help optimize mucosal immune surveillance. IntroductionNotch receptors are transmembrane receptors that, when activated by one of several known ligands (Delta-like/Serrate or Jagged), undergo proteolytic processing and nuclear localization to directly activate expression of gene targets (–). In the immune system, Notch signaling regulates the development and effector cell induction of several cell types including T and B lymphocytes and dendritic cells; the expression of Notch receptors and ligands is distributed among many cell types with many of the direct interactions still only incompletely understood (–). However, known functions of Notch also extend to more basic developmental processes, where cell fates and tissue patterning are regulated. These decisions are made as a consequence of direct cell-cell signaling, where a cell expressing a Notch ligand influences the fate of an adjacent cell expressing a Notch receptor. Thus, tissue patterns can be established or reinforced by the directional interactions between cells with regulated expression of Notch ligands and receptors.

These interactions can result in lateral inhibition or lateral activation, with Notch activation inhibiting or inducing the development of a particular phenotype. These effects can be used to limit the production of specialized cells along a default pathway, or to help establish tissue boundaries.Notch and its ligands can be used to develop rather complex patterns of specialized cell types, and this is especially notable in the development of sensory organs, such as the Drosophila eye disc, where Notch signaling insures regular spacing of photoreceptor cells. In the mammalian inner ear, Notch signaling appears to insure the orderly arrangement of hair cells (–).

This appears to be in part by lateral inhibition mediated by Delta-like 1, but in these studies it has also been suggested that there is also an (as yet unproven) inductive signal provided by Jagged1. Thus, the possibility has been raised that a single Notch ligand may simultaneously provide both trans-inhibitory and cis-inductive signals, depending on the cellular context.In the intestine, Notch has an important role in regulating intestinal epithelium lineage specification; Notch signaling suppresses the development of secretory cell types such as goblet cells (–). The production of secretory cells is not associated with sensory function, but the production of another specialized intestinal epithelial cell, the M cell, does fit the sensory organ pattern. M cells are mainly found in Peyer’s patch follicle associated epithelium (PPFAE), and are responsible for the capture of lumenal particles such as bacteria and viruses, and transcytosis across the epithelial barrier to underlying dendritic cells, triggering mucosal immune responses (–).

The distribution of M cells in the PPFAE appears to be highly regulated, with a distributed checkerboard pattern (–). In addition, goblet cells are less frequent in PPFAE than in neighboring villi, with correspondingly less mucus over the PPFAE epithelium.

Since the localized assembly of M cells in PPFAE comprises a mucosal immune surveillance unit, their organized pattern may be beneficial to their function.We recently reported that in a cell culture model of M cell function, the expression of the Notch ligand Jagged1 was increased in M cell-like cells , raising the possibility that its expression and interaction with Notch receptors may influence development of M cells in the PPFAE. However, in a survey of Notch and Notch ligand expression in the gut , Jagged1 expression was primarily detected in the intestinal crypt, suggesting that if Jagged1 is indeed influencing M cell development, it may be primarily at the earliest stages in lineage decisions (–). Here we report the results of studies on the requirements for Notch and Jagged1 in M cell development and distribution in PPFAE. Our results are consistent with the notion that M cell expression of Jagged1 and Notch may have an editing effect on the production and distribution of M cells across the PPFAE, while also having a slight inductive influence on committed M cells. AnimalsVilCre mice (Jax #4586, expressing Cre recombinase under the Villin promoter), FloxNotch1 mice (Jax #6951), and FloxJag1 mice (Jax #10618), all on the C57BL/6 background, were purchased from Jackson Labs (Bar Harbor, ME, USA) and bred in the UC Riverside vivarium under SPF conditions. All mice were genotyped according to Jackson Lab website protocols. Conditional Notch1 KO mice were generated by crossing VilCre with FloxNotch1; conditional knockouts were homozygous for FloxNotch1, while controls were heterozygous.

The same strategy was used to generate conditional knockout Jagged1 KO mice. All mice were used around 8 weeks of age. Mice were handled according to institutional IACUC and NIH guidelines. Cell line and tissue cultureCaco-2BBe cells were obtained from ATCC and cultured with ADMEM with 10%FBS, 1.5% penicillin/streptomycin, and 10mM HEPES. For qPCR analysis, 500,000 cells were plated in 12 well plates for 24 hours.

Cytokines were added at the time of plating at the concentration of 100ng/ml for TNFα (Peprotech, Rocky Hill, NJ, USA) and 5ug/ml of LTβR agonist (R&D Systems, Minneapolis, MN, USA). Conditions for cytokine induction were developed and reported by Wang et al. Jagged1 peptide (Anaspec, Fremont, CA, USA) was used at 4 or 40uM in culture, added at the time of plating and continued culture for 24 hours. For DAPT (Tocris Bioscience, Minneapolis, MN, USA) treatment, DAPT was added to the culture at the time of plating at the concentration of 10uM and 100uM and followed by combined cytokine treatment 4 hours after plating. DAPT treated samples were compared with control samples treated with DMSO at the same concentration. The data for cytokine induction of CD137 and Jagged1, and CD137 inhibition by DAPT shown in the figures is the mean “fold-increase” compared to control non-cytokine treated cultures, determined from three independent biological replicate experiments (shown as the mean and SEM of the three experiments together), with each individual experiment showing the same trends.

Real Time-PCRFor quantitative PCR analysis of gene expression in Caco-2BBe cells, RNA was harvested after 24 hours of culture with TRIZOL (Invitrogen, Grand Island, NY, USA); next, 2μg of total RNA was made into cDNA using Superscript III first-strand synthesis system (Invitrogen). Quantitative PCR was performed using a CFX96 Real-Time PCR detection system (BioRad, Hercules, CA, USA) using SYBR Green for quantification of PCR product. All samples were calibrated for relative expression using GAPDH in parallel reactions as the reference housekeeping gene. All PCR assays were done in triplicate in 96 well plates with at least 3 replicate experiments with similar results; error bars shown reflect the variation in three independent biological replicate experiments. Relative mRNA expression was calculated using the ΔΔCT method. Primers used for Real-time PCR (all sequences are 5’ to 3’) were: GAPDH, For- CATGAGAAGTATGACAACAGCCT, Rev- AGTCCTTCCACGATACCAAAGT; CD137, For- AGGTGTTTTCAGGACCAGGAAGGA, Rev- GTCGACAGATGCCACGTTTCTGAT; Jagged1, For- TACACTGCCTGCCTTAAGTGAGGA, Rev- CACGGTCTCAATGGTGAACCAACA.

Immunohistochemistry and confocal microscopyFor whole mount Peyer’s patch microscopy, freshly dissected Peyer’s Patches from the small intestine (typically 6 to 8 Peyer’s patches recovered from stomach to cecum) were washed briefly in PBS then kept in 4% paraformaldehyde in PBS/ 30% sucrose for 30 minutes. Samples were then washed with 0.1% Tween in PBS twice and blocked with Casein 0.1% Tween for another 30 minutes. For primary antibody staining, Rhodamine conjugated UEA-1 (Vector Laboratories, Burlingame, CA, USA) was used. Whole mount Peyer’s patches were then cleaned and mounted after 10 minutes of 4% PFA post-fix. Samples were washed with 3 times PBS 0.1% Tween and followed by secondary staining (Streptavidin Alexa 647 (Invitrogen)). For goblet cell staining, intestines (also from the small intestine between stomach and cecum) were kept on ice in 4% paraformaldehyde/PBS/30% sucrose for 3 hours before freezing.

Cryostat sections were stained with Alcian blue (Sigma-Aldrich, St. Louis, MO, USA) for 1 minute and cleaned using tap water until washes were clean.

Images were taken using bright field microscopy. Staining of Caco-2BBe cells for CD137 and Jagged1 was performed as follows: 50,000 Caco-2BBe cells were plated in chamber slides (BD Biosciences, San Jose, CA) with the same cytokine concentrations as for qPCR culture for 48 hours before staining. Staining was done using Jagged1 rabbit antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and CD137 goat antibody (Santa Cruz), using donkey anti-goat Alexa 488 and donkey anti-rabbit Alexa 647 (Invitrogen) as secondary reagents.

Goblet cell count and M cell density analysisGoblet cell counts was assessed by counting the number of goblet cells over the distance on the basement membrane obtained from stained intestinal cryostat sections. Each data point was the analysis from a single confocal z-stack image. For M cell quantification, mice were used at 8 weeks of age. Images were taken from whole mount Peyer’s patches through confocal microscopy and analyzed using Volocity 5 software (PerkinElmer, San Jose, CA, USA).

M cell counts were counted based on UEA-1 staining, which distinguishes goblet cells and M cells by differences of brightness and shapes. Adjacent cell percentages were calculated by the number of M cells with contiguous edges in direct contact over a length of 3 μm, divided by the total M cells counted from the same follicle. Each data point was the analysis from a single image, and data was accumulated from multiple Peyer’s patches from at least three different mice for each genotype. Statistical tests were performed using Prism software (GraphPad, La Jolla, CA, USA). We used a two-tailed t-test for M cell and goblet cell density counts, and Mann-Whitney for percentage clustering analysis, though similar results were obtained using either method. For quantitative PCR analysis, three independent biological replicate cultures and each associated PCR assay result (in fold induction) was combined for statistical analysis.

Removal of epithelial Notch increases both goblet cell and M cell lineages in the intestineNotch signaling has a critical role in intestinal epithelium lineage fate decisions; blocking Notch signaling resulted in the nearly exclusive production of goblet cells at the expense of other cell types (; ). However, in the epithelium overlying intestinal Peyer’s patches, the influence of cytokines from lymphoid cells including lymphoid tissue inducer cells (LTi) changes the local context, dramatically altering patterns of gene regulation. For example, in contrast to neighboring villous epithelium, PPFAE show expression of genes such as CCL20 (; ). The development of M cells is even more complex, since local conditions only induce a subset of epithelial cells to the M cell lineage; the regulation of this selective induction remains to be explained.

If Notch influences M cell lineage decisions in the same way it affects goblet cells, then an increase in M cell numbers in mice lacking epithelial Notch expression might be evidence for Notch regulation of M cell production.Intestinal epithelium may use Notch1 or Notch2 to mediate signaling; here, we used a conditional deletion of Notch1 in intestinal epithelium. A floxed Notch1 allele was crossed to a transgene expressing Cre recombinase driven by the Villin promoter. This transgene is expressed early in the intestinal epithelium during development (; ), and appears to be specific to intestinal epithelium.

As confirmation of this strategy, mice homozygous for the floxed Notch1 allele and carrying the Vil-Cre transgene showed approximately two-fold increased numbers of goblet cells throughout the intestinal villi as compared to mice heterozygous for the floxed allele. Consistent with previous effects of a complete block in Notch signaling, these results confirm the major influence of Notch1 signaling on intestinal epithelium lineage fate. Goblet cells on small intestine villi are greatly increased in the absence of Notch1A. Control villi (single floxed Notch1) stained for goblet cells using Alcian Blue, showing normal dispersed distribution and density of goblet cells on intestinal villi. (Scale bar: 50 um)B.

FloxNotch/VilCre villi stained with Alcian Blue. Here, there is greatly increased goblet cell density, with many goblet cells directly adjacent to each other. (Scale bar: 50 um)C. Quantitation of goblet cell density in wild type and Notch1 conditional knockout villi. Goblet cell density was measured by goblet cell counts per villous basement membrane length.

The Notch1 conditional knockout villi showed approximately double the density of goblet cells versus control villi. (single flox Notch N=22; FloxNotch N=15;., P.

Peyer’s patch M cells show increased numbers and clustering in floxNotch miceA. Quantitation of M cell density across Peyer’s patch epithelium, measured by direct counting of M cells per Peyer’s patch follicle epithelium surface area. Notch1 conditional knockout Peyer’s patches contained a higher density of M cells. (single flox Notch N=11; FloxNotch N=10;., P. Deletion of epithelial Jagged1 reduces PPFAE M cell numbers while increasing M cell clusteringGoblet cell lineage commitment is determined in the intestinal crypt, regulated in part by expression of Delta-like 1 (Dll1) expression (;; ). Interestingly, Dll1 may have both a lateral inhibition effect on Notch-expressing cells, and a positive induction effect that may be Notch-independent; unfortunately, details on this mechanism are limited, since Dll1 expression is only transiently evident in the crypt cells (; ).

In the case of PPFAE M cells, a similar challenge is present for deciphering any potential role of Jagged1, which we identified in a cell culture model as a candidate gene in M cell development. As noted earlier, Jagged1 expression is mainly limited to the lower crypt, so any influence of Jagged1 expression may be limited to the early stages in the crypt followed by reduced Jagged1 expression thereafter. In addition, we previously reported evidence that early lineage decisions toward M cell commitment occur prior to expression of other M cell associated genes such as CD137, gp2, and PGRP-S (; ), so for Jagged1 to influence M cell development, it should also be at an early stage in lineage commitment.We examined the development of M cells in mice homozygous for a floxed Jagged1 gene plus the villin-Cre transgene, so that Jagged1 was specifically eliminated only in the intestinal epithelium. As with the floxed Notch mice, we assayed for M cell numbers and distribution. In contrast to the floxed Notch mice, M cell numbers were reduced by about 25%.

However, despite this reduction the proportion of clustered M cells was actually increased , consistent with loss of lateral inhibition. Interestingly, PPFAE goblet cell numbers were also decreased. Here too, because of parallel decreases in both M cells and goblet cells, it seems unlikely that changes in M cell numbers due to loss of Jagged1 signaling can be explained by alterations in M cell morphology.

Thus, the expression of Jagged1 in PPFAE appears to be involved in the control of M cell numbers with additional effects on goblet cells, and may also mediate lateral inhibition effects to limit M cell clustering. FloxJagged1 Peyer’s patches have fewer M cells but increased clusteringA. Direct quantitation of M cell density across Peyer’s patch epithelium showed that, in contrast to Notch1 conditional knockout mice, there were reduced numbers in Jagged1 conditional knockout mice compared to wild type. (single flox Jag1 N=32; FloxJag1 N=32;., P. Jagged1 and CD137 are coordinately regulated in a cell culture model of M cell gene expressionOur studies in vivo suggested that while Notch signaling has an inhibitory effect on M cell numbers and clustering, Jagged1 has paradoxical inhibitory effects on clustering but positive effects on M cell numbers.

These results raised the possibility that Jagged1 has both cis and trans activity, so we examined possible gene interactions in a cell culture model of M cell associated gene regulation. In earlier studies on a Caco-2 co-culture model of M cell-like induction, we found that Jagged1 transcripts were induced , so we also studied Jagged1 expression in a more recent study on the induction of M cell associated genes. We recently reported that a combination of agonists for the TNFα receptors and the LTβR induced upregulation of PPFAE and M cell associated genes in the intestinal epithelium cell line Caco-2BBe. Among the induced genes was CD137, a member of the TNFR superfamily gene CD137 (; ), which proved to be required for M cell functional development but not lineage commitment in vivo. In this context, we also found a consistent 2–3-fold increase in Jagged1 expression similar to the level of induction in the Caco-2 coculture studies.

Under similar conditions, strong induction of CD137 was also evident. Jagged2 induction was less than 1.5-fold (not shown). In immunohistochemical analysis of the Caco-2BBe cells , Jagged1 protein was already evident in untreated cells, so upregulation was subtle. It should be noted that expression of Jagged1 in Caco-BBe cells is consistent with studies suggesting that freshly passaged Caco-2 cells resemble crypt cells both in terms of their initial lack of brush border microvilli and patterns of gene expression (–). The staining for Jagged1 was distributed in the nucleus, cytoplasm and in part also on the cell membrane, while CD137 was found in cytoplasmic vesicles as previously reported.

Both Jagged1 and CD137 were detected in the same cells, consistent with cis interactions; however, CD137 was found in cytoplasmic vesicles that did not co-localize with Jagged1. Studies on Caco-2BBe cell gene expression show coordinate regulation of M cell genes Jagged1 and CD137A.

TNFα plus LTβR agonist (“Cytokine”: 100ng/ml TNFα and 5μg/ml of LTβR agonist antibody) induced upregulation of Jagged1 with no additional influence of soluble CD137L agonist. (t-test analysis;., P. DiscussionOur studies provide evidence that Jagged1 and Notch influence PPFAE M cell numbers and distribution by regulating M cell development at an early stage within the crypts adjacent to the Peyer’s patch follicle. While it is unclear what factors cause the initial commitment of crypt stem cells to M cell versus enterocyte phenotypes, the present data suggest that the eventual output of M cells from the crypt is subject to editing through signals such as Jagged1-Notch interactions. The effect of Notch signaling appears to be complex and context-dependent, as the loss of Jagged1 suggests the possibility of both trans-inhibitory and cis-inducing effects on M cells. Consistent with this dual role, preliminary analysis of mice with intestinal epithelium expression of a constitutively active human Notch cytoplasmic domain showed no significant effect on PPFAE M cell numbers (not shown); here it is likely that the Notch signaling was both inhibitory on some cells yet reinforcing in others, resulting in a balanced effect on total M cell numbers. The possibility of simultaneous trans-inhibitory and cis-inducing functions of Jagged1 in the editing of PPFAE M cells is consistent with studies on other Notch ligands; for example, cell-autonomous Delta-Notch signaling has been implicated in Drosophila hair bristle formation.

Considered in aggregate, the effects of Notch signaling appear to insure the scattered distribution of M cells across the PPFAE , a necessarily dynamic function in the face of continuous regeneration of the short-lived Peyer’s patch epithelial cells. Model of Jagged-Notch interactions and M cell patterns in Peyer’s patch epitheliumA.

A low magnification view of the overall distribution of M cells (green) across Peyer’s patch follicle epithelium. Note that at this low magnification, dispersion of M cells derived from crypt stem cell progenitors is evident, though the rare M cell clusters are not as visible.B.

Simplified cartoon model of M cell editing by Jagged1 and Notch interactions, indicating a possible role for Jagged1 in both lateral inhibition of M cell development and cis-reinforcement of M cell lineage decisions.If we view the distributed array of M cells across the PPFAE as a type of sensory organ with a defined tissue pattern , then Jagged1 and Notch are appropriate candidates for regulating intestinal crypt production of M cells. A regulated M cell distribution could have several benefits. First, the full surface area of the follicle epithelium would be used to optimum efficiency, with optimum distribution of M cell-specific capture receptors such as gp2.

In addition, the dendritic cells underlying the follicle epithelium would all have similar opportunity to take up antigens transcytosed by the M cells and present them to nearby interfollicular zone T lymphocytes. Second, because M cells have a basolateral pocket containing B lymphocytes, the dispersal of M cells may minimize the disadvantages of epithelial cells with reduced basement membrane contacts and potential for loss of epithelial integrity and barrier function.A third potential benefit of dispersed M cells was raised in our recent studies on particle uptake by Nasal Associated Lymphoid Tissue M cells. We found that the ionic strength of the dispersion buffer affected M cell-dependent uptake, suggesting a role for electrostatic forces in M cell function. Since cell membranes and biological particles (e.g., bacteria and viruses) are nearly always negatively charged, electrostatic repulsion between the membranes and particles would minimize direct interactions. However, the smooth (“microfold”) apical membranes of M cells may have lower surface charge relative to adjacent enterocytes with extensive microvilli, so electrostatic forces might drive particles toward the M cell membranes. Thus, dispersed M cells surrounded by microvilli-covered enterocytes may be most effective in taking advantage of both long range electrostatic forces and short range interactions between capture receptors and target ligands.The contrast between intestinal villus and Peyer’s patch epithelium organization of specialized cell types is striking in view of the common contribution of crypt stem cells to both.

We found that while Notch signaling clearly regulates the production of both goblet cells and M cells, it is the local environment (villus vs PPFAE) that determines whether the main non-enterocyte produced is a goblet cell or M cell. That is, the proximity to the Peyer’s patch provides the context that promotes the generation of M cells rather than goblet cells. In addition, cis-signaling may provide yet additional specificity in a binary choice between goblet versus M cell phenotype; a speculative hypothesis is that Jagged1 helps support the M cell lineage while Delta-like 1 provides cis-signaling for nascent goblet cells. In pathological settings such as inflammatory bowel disease, these context-dependent contrasts may be important determinants of whether the local crypts are induced to provide additional goblet cells or M cells.

Conflicts: The authors have no conflicts of interest.Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript.

The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.